about | help | code help+videos | done | prefs |
Write a function findATG(dna) that returns a list of indices of all of the positions (indices) where the codon ATG begins in the given DNA string. Do not use the built-in index method or find method. Constructing the list of indices is very similar to what we have done several times in building lists to plot. Assume dna is all lowercase, and read through it from left to right. findATG('agcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgcc') → [29] findATG('gtgagtaaattaaaattttattgacttaggtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtac') → [] findATG('') → [] ...Save, Compile, Run (ctrl-enter) |
Progress graphs:
Your progress graph for this problem
Random user progress graph for this problem
Random Epic Progress Graph
Copyright Nick Parlante 2017 - privacy