id/email
password
forgot password | create account
about | help | code help+videos | done | prefs
CodingBat code practice

 

basePairs


Write a method that accepts a string representing a sequence of DNA. You are supposed to either find the matching DNA base-pairs, or find the transcribed RNA. If the value of the Boolean variable 'transcribe' is false, return the matching DNA base-pairs, while if 'transcribe' is true, return the sequence for the transcribed RNA). Look at the test data for examples. Note: DNA Base-pairing rules A-->T and T-->A, G-->C and C-->G; RNA Base-pairing rules A-->U and T-->A, G-->C and C-->G.


basePairs("TTAACCCCGGGA", false) → "AATTGGGGCCCT"
basePairs("CGGGGTTA", true) → "GCCCCAAU"
basePairs("CCATGGTTGAGACCATCCGATAAGCTCGACGA", true) → "GGUACCAACUCUGGUAGGCUAUUCGAGCUGCU"

...Save, Compile, Run (ctrl-enter)

public String basePairs(String sequence, boolean transcribe) { }

Editor font size %:
Shorter output


Forget It! -- delete my code for this problem

Progress graphs:
 Your progress graph for this problem
 Random user progress graph for this problem
 Random Epic Progress Graph

Java Help

Misc Code Practice

Difficulty: 250

Copyright Nick Parlante 2017 - privacy