| about | help | code help+videos | done | prefs |
Write a method that accepts a string representing a sequence of DNA. You are supposed to find the matching DNA base-pairs and return a string representing those matching base-pairs. Look at the test data for examples. Note: DNA Base-pairing rules A-->T and T-->A, G-->C and C-->G. basePairsDNA("TTAACCCCGGGA") → "AATTGGGGCCCT" basePairsDNA("CGGGGTTA") → "GCCCCAAT" basePairsDNA("CCATGGTTGAGACCATCCGATAAGCTCGACGA") → "GGTACCAACTCTGGTAGGCTATTCGAGCTGCT" ...Save, Compile, Run (ctrl-enter) |
Progress graphs:
Your progress graph for this problem
Random user progress graph for this problem
Random Epic Progress Graph
Difficulty: 210
Copyright Nick Parlante 2017 - privacy