about | help | code help+videos | done | prefs |
basePairsRNA
Write a method that accepts a string representing a sequence of DNA. You are supposed to find the transcribed RNA that matches that DNA sequence. Look at the test data for examples. Note: RNA Base-pairing rules A-->U and T-->A, G-->C and C-->G. basePairsRNA("TTAACCCCGGGA") → "AAUUGGGGCCCU" basePairsRNA("CGGGGTTA") → "GCCCCAAU" basePairsRNA("CCATGGTTGAGACCATCCGATAAGCTCGACGA") → "GGUACCAACUCUGGUAGGCUAUUCGAGCUGCU" ...Save, Compile, Run (ctrl-enter) |
Progress graphs:
Your progress graph for this problem
Random user progress graph for this problem
Random Epic Progress Graph
Difficulty: 210
Copyright Nick Parlante 2017 - privacy